Top » Catalog » R1b » A1540

$18.00

A1540
[A1540]

A1540
hg38 Position: ChrY:16025277..16025277
Ancestral: C
Derived: A
Reference: Robert Hughes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream Z16329
Forward Primer: A1540_F CTGTCACCATCACCCATCAC
Reverse Primer: A1540_R GCAAAGCTCTAGCCCACTACC
Reviews

Customers who bought this product also purchased
Y3640
Y3640
DNA Sample Kit
DNA Sample Kit
Z345
Z345
A1539
A1539
Z16330
Z16330
R1b-Z16330 downstream panel
R1b-Z16330 downstream panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A687
1 x A1343
1 x A1504
1 x A807
1 x A593
1 x A564
1 x A2233
$126.00
Haplogroup Info
Other products
Currencies