Top » Catalog » R1b » A1541

$18.00

A1541
[A1541]

A1541
hg38 Position: ChrY:21437072..21437072
Ancestral: G
Derived: C
Reference: Robert Hughes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream Z16329
Forward Primer: A1541v3_F GTAAGTTAATTTTCTGTTCATAAAGGAAATAG
Reverse Primer: A1541v3_R AACACTTTTTCCAACATCTTTGC
Reviews

Customers who bought this product also purchased
A1543
A1543
A1540
A1540
A1539
A1539
Z16330
Z16330
R1b-Z16330 downstream panel
R1b-Z16330 downstream panel
Z17619
Z17619
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1511
1 x A675
$36.00
Haplogroup Info
Other products
Currencies