Top » Catalog » R1b » A1543

$18.00

A1543
[A1543]

A1543
hg38 Position: ChrY:8343699..8343699
Ancestral: A
Derived: C
Reference: Robert Hughes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream Z16329
Forward Primer: A1543_F AATGTCACAAAAGATTACAACATTTACAC
Reverse Primer: A1543_R GCCCAGGTAGGAGAATCATG
Reviews

Customers who bought this product also purchased
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
Z16325
Z16325
L1065
L1065
S691
S691
S764
S764
Z16331
Z16331
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies