Top » Catalog » R1b » A1543

$18.00

A1543
[A1543]

A1543
hg38 Position: ChrY:8343699..8343699
Ancestral: A
Derived: C
Reference: Robert Hughes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream Z16329
Forward Primer: A1543_F AATGTCACAAAAGATTACAACATTTACAC
Reverse Primer: A1543_R GCCCAGGTAGGAGAATCATG
Reviews

Customers who bought this product also purchased
Z16325
Z16325
L1065
L1065
S691
S691
S764
S764
Z16331
Z16331
S744
S744
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies