Top » Catalog » R1b » A1544

$18.00

A1544
[A1544]

A1544
hg38 Position: ChrY:8618013..8618013
Ancestral: A
Derived: G
Reference: Robert Hughes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream Z16329
Forward Primer: A1544_F CCCCTCAACAACTCATCAGG
Reverse Primer: A1544_R CATTTGCTGTGATGGTGGTC
Reviews

Customers who bought this product also purchased
Z17619
Z17619
A1543
A1543
A1541
A1541
A1540
A1540
A1539
A1539
Z16330
Z16330
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies