Top » Catalog » R1b » A1544

$18.00

A1544
[A1544]

A1544
hg38 Position: ChrY:8618013..8618013
Ancestral: A
Derived: G
Reference: Robert Hughes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream Z16329
Forward Primer: A1544_F CCCCTCAACAACTCATCAGG
Reverse Primer: A1544_R CATTTGCTGTGATGGTGGTC
Reviews

Customers who bought this product also purchased
A1541
A1541
A1540
A1540
A1539
A1539
Z16330
Z16330
R1b-Z16330 downstream panel
R1b-Z16330 downstream panel
Z17619
Z17619
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies