Top » Catalog » R1b » A2217

$18.00

A2217
[A2217]

A2217
hg38 Position: ChrY:14362439..14362439
Ancestral: A
Derived: G
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below M222 > FGC5939.2
Forward Primer: A2217_F GCTCTGGACAGAAGATAGAAAGACTG
Reverse Primer: A2217_R ACTATTCTCACCAATCACAAAGGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies