Top » Catalog » R1b » A2225

$18.00

A2225
[A2225]

A2225
hg38 Position: ChrY:15237936..15237936
Ancestral: C
Derived: A
Reference: James Kane (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b4b
Comments: Found in CTS4466 samples. Downstream of S1121.
Forward Primer: A2225_F GTTTTCCTGGGTCATAATTTGG
Reverse Primer: A2225_R GATTTTTGCCTTCTGACCATATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A994
$18.00
Haplogroup Info
Other products
Currencies