Top » Catalog » R1b » A2226

$18.00

A2226
[A2226]

A2226
hg38 Position: ChrY:26632625..26632625
Ancestral: T
Derived: C
Reference: James Kane (2015)
ISOGG Haplogroup: R1b1a2a1a2c1c2 (not listed)
Comments: Found in CTS4466 samples. Downstream of S1121.
Forward Primer: A2226_F CATTGCCTATTCCCGTCG
Reverse Primer: A2226_R TACAATTTCCCTGGAAGTAAGCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies