Top » Catalog » R1b » A2219

$18.00

A2219
[A2219]

A2219
hg38 Position: ChrY:7799384..7799384
Ancestral: C
Derived: T
Reference: James Kane (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1a3a
Comments: Found in CTS4466 samples. Downstream of Z16259.
Forward Primer: A2219_F AAGAACTTAGGGTTTGTCTGTAACAAC
Reverse Primer: A2219_R GATGGTACTTCCTAGCTCTAAAGTTCC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1251
1 x A167
1 x A151
1 x A308
1 x A2121
$90.00
Haplogroup Info
Other products
Currencies