Top » Catalog » R1b » A2219

$18.00

A2219
[A2219]

A2219
hg38 Position: ChrY:7799384..7799384
Ancestral: C
Derived: T
Reference: James Kane (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1a3a
Comments: Found in CTS4466 samples. Downstream of Z16259.
Forward Primer: A2219_F AAGAACTTAGGGTTTGTCTGTAACAAC
Reverse Primer: A2219_R GATGGTACTTCCTAGCTCTAAAGTTCC
Reviews

Customers who bought this product also purchased
A88
A88
L513
L513
S1115
S1115
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Z16259
Z16259
DF21
DF21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1303
$18.00
Haplogroup Info
Other products
Currencies