Top » Catalog » R1b » A2219

$18.00

A2219
[A2219]

A2219
hg38 Position: ChrY:7799384..7799384
Ancestral: C
Derived: T
Reference: James Kane (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1a3a
Comments: Found in CTS4466 samples. Downstream of Z16259.
Forward Primer: A2219_F AAGAACTTAGGGTTTGTCTGTAACAAC
Reverse Primer: A2219_R GATGGTACTTCCTAGCTCTAAAGTTCC
Reviews

Customers who bought this product also purchased
A88
A88
FGC11134
FGC11134
S1121
S1121
DF13
DF13
A2220
A2220
L513
L513
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies