Top » Catalog » R1b » A2220

$18.00

A2220
[A2220]

A2220
hg38 Position: ChrY:14157724..14157724
Ancestral: C
Derived: A
Reference: James Kane (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1a3
Comments: Found in CTS4466 samples. Downstream of Z16259.
Forward Primer: A2220_F TTTTTGGAGACAGGGTCTCAG
Reverse Primer: A2220_R TGGTGCAACCCTTAAGCAAC
Reviews

Customers who bought this product also purchased
DF49
DF49
FGC11134
FGC11134
A12017
A12017
DF13
DF13
L513
L513
A2295
A2295
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2206
1 x A1053
1 x A2193
$54.00
Haplogroup Info
Other products
Currencies