Top » Catalog » R1b » A2220

$18.00

A2220
[A2220]

A2220
hg38 Position: ChrY:14157724..14157724
Ancestral: C
Derived: A
Reference: James Kane (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1a3
Comments: Found in CTS4466 samples. Downstream of Z16259.
Forward Primer: A2220_F TTTTTGGAGACAGGGTCTCAG
Reverse Primer: A2220_R TGGTGCAACCCTTAAGCAAC
Reviews

Customers who bought this product also purchased
A2295
A2295
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
DF21
DF21
A2219
A2219
Z253
Z253
FGC5494
FGC5494
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A390
1 x A569
1 x A2217
1 x A610
1 x A1743
1 x A895
1 x A61
1 x A532
1 x A1256
$162.00
Haplogroup Info
Other products
Currencies