Top » Catalog » T » A25064

$18.00

A25064
[A25064]

A25064
hg38 Position: ChrY:14574864..14574864
Ancestral: G
Derived: A
Reference: Petr Soucek (2019)
ISOGG Haplogroup: T1
Comments:
Forward Primer: A25064_F GCCCATTTACATTTAAGATTAGCC
Reverse Primer: A25064_R AGAACGCCACAAAGATACTCCC
Reviews

Customers who bought this product also purchased
FT83445
FT83445
FT83370
FT83370
FT84198
FT84198
FGC78691
FGC78691
FT84172
FT84172
A25063
A25063
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y49845
$18.00
Haplogroup Info
Other products
Currencies