Top » Catalog » T » FT84172

$18.00

FT84172
[FT84172]

FT84172
hg38 Position: ChrY:22242670..22242670
Ancestral: G
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: T1
Comments: .
Forward Primer: FT84172_F GTGATGGCTATGTGGGCTG
Reverse Primer: FT84172_R GTCAAATTGTCTCTGTTTGCAGAC
Reviews

Customers who bought this product also purchased
A25062
A25062
FT83445
FT83445
FT83370
FT83370
FT84198
FT84198
FGC78691
FGC78691
A25064
A25064
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A6971
1 x A7442
1 x A6577
1 x Y14405
1 x BY13768
1 x FGC21107
1 x BY14165
$126.00
Haplogroup Info
Other products
Currencies