Top » Catalog » T » CTS2336

$18.00

CTS2336
[CTS2336]

CTS2336
hg38 Position: ChrY:12145547..12145547
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: T1a
Comments: Also hg T: Syn. with CTS10278; downstream CTS2888
Forward Primer: CTS2336_F AGTTACCCCAGAACCCCTG
Reverse Primer: CTS2336_R CACTATATATATAATATTTTAATAAAATTGTCCATG
Reviews

Customers who bought this product also purchased
A5408
A5408
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY9923
1 x FGC31455
1 x ALK505
1 x Y48563
$72.00
Haplogroup Info
Other products
Currencies