Top » Catalog » T » Y5685

$18.00

Y5685
[Y5685]

Y5685
hg38 Position: ChrY:21699610..21699610
Ancestral: G
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: T1a1a1b2b2b1a1a1b2a
Comments: Below FGC4035/Y5690; aka FGC4065
Forward Primer: Y5685_F TGTTTCCTCTCCAGGGACG
Reverse Primer: Y5685_R TCCATACTGAGGACTGCAGAGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies