Top » Catalog » T » CTS2214

$18.00

CTS2214
[CTS2214]

CTS2214
hg38 Position: ChrY:12099450..12099450
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: T1a1a1b2
Comments: Extracted from 1000 genomes data. Not qualified. Below FGC3995/Y4119
Forward Primer: CTS2214_F GTTACTTTTTGAATATTATTGCTGTCG
Reverse Primer: CTS2214_R GGCTAATATTATGATTATGTCTTGAGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies