Top » Catalog » T » Y14426

$18.00

Y14426
[Y14426]

Y14426
hg38 Position: ChrY:12707352..12707352
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: T1a1a1b2b2a (not listed)
Comments: Below Y6409
Forward Primer: Y14426_F GCGGTTTAATCATGGCAGAC
Reverse Primer: Y14426_R TTGTTATTAACCACCTTCACAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y16247
$18.00
Haplogroup Info
Other products
Currencies