Top » Catalog » T » A19711

$18.00

A19711
[A19711]

A19711
hg38 Position: ChrY:8827928..8827928
Ancestral: T
Derived: C
Reference: YSEQ (2017)
ISOGG Haplogroup: T
Comments: .
Forward Primer: A19711_F AACATTAGTTACCATTTCTGAACATTG
Reverse Primer: A19711_R TTGAGACAGAGTCTCACTCTGTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies