Top » Catalog » T » FGC30193

$18.00

FGC30193
[FGC30193]

FGC30193
hg38 Position: ChrY:9983243..9983243
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: T
Comments: .
Forward Primer: FGC30193_F TACTCGGGAGGCTTATGCAG
Reverse Primer: FGC30193_R TTGTAAGAGCACTGAAAAACCAAC
Reviews

Customers who bought this product also purchased
FGC30203
FGC30203
FGC30211
FGC30211
FGC30200
FGC30200
FGC30210
FGC30210
FGC30198
FGC30198
FGC30209
FGC30209
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y4122
$18.00
Haplogroup Info
Other products
Currencies