Top » Catalog » T » FGC30194

$18.00

FGC30194
[FGC30194]

FGC30194
hg38 Position: ChrY:9991000..9991000
Ancestral: A
Derived: C
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: T
Comments: .
Forward Primer: FGC30194_F CCCGGTCTACTAGGGGTTTG
Reverse Primer: FGC30194_R CTAGCACTTTGGGAGGCAAG
Reviews

Customers who bought this product also purchased
FGC30198
FGC30198
FGC30209
FGC30209
FGC30193
FGC30193
FGC30208
FGC30208
FGC30215
FGC30215
FGC30190
FGC30190
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies