Top » Catalog » T » FGC30194

$18.00

FGC30194
[FGC30194]

FGC30194
hg38 Position: ChrY:9991000..9991000
Ancestral: A
Derived: C
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: T
Comments: .
Forward Primer: FGC30194_F CCCGGTCTACTAGGGGTTTG
Reverse Primer: FGC30194_R CTAGCACTTTGGGAGGCAAG
Reviews

Customers who bought this product also purchased
FGC30206
FGC30206
FGC30212
FGC30212
FGC30203
FGC30203
FGC30211
FGC30211
FGC30200
FGC30200
FGC30210
FGC30210
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies