Top » Catalog » T » FGC30200

$18.00

FGC30200
[FGC30200]

FGC30200
hg38 Position: ChrY:13558953..13558953
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: T
Comments: .
Forward Primer: FGC30200_F CAATGATGTCGTTCCTGGTG
Reverse Primer: FGC30200_R AAACTTGCATTTGAGAGAACCTG
Reviews

Customers who bought this product also purchased
FGC30215
FGC30215
FGC30190
FGC30190
FGC30206
FGC30206
FGC30212
FGC30212
FGC30203
FGC30203
FGC30211
FGC30211
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY8389
1 x A18555
1 x CTS8995
1 x Y16958
1 x BY7510
1 x A10248
1 x BY32685
$126.00
Haplogroup Info
Other products
Currencies