Top » Catalog » T » FGC30215

$18.00

FGC30215
[FGC30215]

FGC30215
hg38 Position: ChrY:15703796..15703796
Ancestral: del
Derived: ins
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: T
Comments: .
Forward Primer: FGC30215v2_F TTATCAGTGAAGTCAAATATCATTTTATGTAG
Reverse Primer: FGC30215v2_R AGAAGTGATTGATATTTTGATAGCCTC
Reviews

Customers who bought this product also purchased
FGC30198
FGC30198
FGC30209
FGC30209
FGC30194
FGC30194
FGC30208
FGC30208
FGC30193
FGC30193
FGC30206
FGC30206
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies