Top » Catalog » SNPs » P312

$18.00

P312
[P312]

P312
hg38 Position: ChrY:19995425..19995425
Ancestral: C
Derived: A
Reference: Karafet et al. (Univ. of Arizona)
ISOGG Haplogroup: R1b1a1a2a1a2
Comments: aka rs34276300
Forward Primer: P312v2_F AAAGATGCAATGGGATAACAG
Reverse Primer: P312v2_R CAAGAAGGTCACTTGAACCAG
Reviews

Customers who bought this product also purchased
Y34174
Y34174
S355
S355
Y31384
Y31384
L11
L11
Y167401
Y167401
S1194
S1194
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies