Top » Catalog » SNPs » P312

$18.00

P312
[P312]

P312
hg38 Position: ChrY:19995425..19995425
Ancestral: C
Derived: A
Reference: Karafet et al. (Univ. of Arizona)
ISOGG Haplogroup: R1b1a1a2a1a2
Comments: aka rs34276300
Forward Primer: P312v2_F AAAGATGCAATGGGATAACAG
Reverse Primer: P312v2_R CAAGAAGGTCACTTGAACCAG
Reviews

Customers who bought this product also purchased
BY251
BY251
Z195
Z195
L283
L283
S170
S170
Z383
Z383
Z2105
Z2105
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies