Top » Catalog » SNPs » P312

$18.00

P312
[P312]

P312
hg38 Position: ChrY:19995425..19995425
Ancestral: C
Derived: A
Reference: Karafet et al. (Univ. of Arizona)
ISOGG Haplogroup: R1b1a1a2a1a2
Comments: aka rs34276300
Forward Primer: P312v2_F AAAGATGCAATGGGATAACAG
Reverse Primer: P312v2_R CAAGAAGGTCACTTGAACCAG
Reviews

Customers who bought this product also purchased
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
A6137
A6137
F1343
F1343
Z2573
Z2573
FGC23071
FGC23071
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies