Top » Catalog » SNPs » P312

$18.00

P312
[P312]

P312
hg38 Position: ChrY:19995425..19995425
Ancestral: C
Derived: A
Reference: Karafet et al. (Univ. of Arizona)
ISOGG Haplogroup: R1b1a1a2a1a2
Comments: aka rs34276300
Forward Primer: P312v2_F AAAGATGCAATGGGATAACAG
Reverse Primer: P312v2_R CAAGAAGGTCACTTGAACCAG
Reviews

Customers who bought this product also purchased
BY25512
BY25512
Y32147
Y32147
FT49932
FT49932
BY251
BY251
BY199059
BY199059
BY105603
BY105603
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies