Top » Catalog » SNPs » A2227

$18.00

A2227
[A2227]

A2227
hg38 Position: ChrY:8383370..8383370
Ancestral: T
Derived: A
Reference: Hamma Bachir (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Below M81 > M5284
Forward Primer: A2227_F CACAATCCCATATATGCGCC
Reverse Primer: A2227_R TTGATAATGACTCTTCTATGGGGAG
Reviews

Customers who bought this product also purchased
BY9954
BY9954
MZ149
MZ149
Y101404
Y101404
MZ19
MZ19
PF2548
PF2548
Z5011
Z5011
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies