Top » Catalog » SNPs » A2227

$18.00

A2227
[A2227]

A2227
hg38 Position: ChrY:8383370..8383370
Ancestral: T
Derived: A
Reference: Hamma Bachir (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Below M81 > M5284
Forward Primer: A2227_F CACAATCCCATATATGCGCC
Reverse Primer: A2227_R TTGATAATGACTCTTCTATGGGGAG
Reviews

Customers who bought this product also purchased
Y190325
Y190325
Y183077
Y183077
FT234139
FT234139
Y141584
Y141584
MZ247
MZ247
BY10132
BY10132
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies