Top » Catalog » SNPs » A2227

$18.00

A2227
[A2227]

A2227
hg38 Position: ChrY:8383370..8383370
Ancestral: T
Derived: A
Reference: Hamma Bachir (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Below M81 > M5284
Forward Primer: A2227_F CACAATCCCATATATGCGCC
Reverse Primer: A2227_R TTGATAATGACTCTTCTATGGGGAG
Reviews

Customers who bought this product also purchased
Z21386
Z21386
Y215326
Y215326
FGC34334
FGC34334
A24296
A24296
Z21384
Z21384
Y141584
Y141584
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies