Top » Catalog » SNPs » A2210

$18.00

A2210
[A2210]

A2210
hg38 Position: ChrY:20739476..20739476
Ancestral: G
Derived: A
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF85
Forward Primer: A2210_F AGGATCTTGCCCCATTTCTC
Reverse Primer: A2210_R AAGCCTCAGCTCTTGTGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies