Top » Catalog » SNPs » A2201

$18.00

A2201
[A2201]

A2201
hg38 Position: ChrY:20436371..20436371
Ancestral: A
Derived: C
Reference: Peter Bradley (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z251 > Z16944
Forward Primer: A2201_F TCCAATACCTAGAAATGTACTTAGCC
Reverse Primer: A2201_R TCTGCATTCTCTCTTCTGTTATATTG
Reviews

Customers who bought this product also purchased
Z251
Z251
FGC34554
FGC34554
BY3015
BY3015
L1335
L1335
S11556
S11556
FGC19534
FGC19534
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18435
1 x mtComplete
1 x mtUpgrade
$298.00
Haplogroup Info
Other products
Currencies