Top » Catalog » SNPs » FGC8393

$18.00

FGC8393
[FGC8393]

FGC8393
hg38 Position: ChrY:14100214..14100214
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: I2a
Comments: Below L161.1 > L1498 > S2742
Forward Primer: FGC8393_F ACAACATGCTGACCTACACTGAG
Reverse Primer: FGC8393_R CCTCTCCTGCCTTCCCTTAG
Reviews

Customers who bought this product also purchased
Y14605
Y14605
Y45481
Y45481
L161.1
L161.1
Y3734
Y3734
A2293
A2293
I2a-M423 Panel
I2a-M423 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies