Top » Catalog » SNPs » FGC8393

$18.00

FGC8393
[FGC8393]

FGC8393
hg38 Position: ChrY:14100214..14100214
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: I2a
Comments: Below L161.1 > L1498 > S2742
Forward Primer: FGC8393_F ACAACATGCTGACCTACACTGAG
Reverse Primer: FGC8393_R CCTCTCCTGCCTTCCCTTAG
Reviews

Customers who bought this product also purchased
I2a-M423 Panel
I2a-M423 Panel
S2742
S2742
CTS4122
CTS4122
A814
A814
A2329
A2329
FGC7126
FGC7126
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies