Top » Catalog » SNPs » FGC8393

$18.00

FGC8393
[FGC8393]

FGC8393
hg38 Position: ChrY:14100214..14100214
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: I2a
Comments: Below L161.1 > L1498 > S2742
Forward Primer: FGC8393_F ACAACATGCTGACCTACACTGAG
Reverse Primer: FGC8393_R CCTCTCCTGCCTTCCCTTAG
Reviews

Customers who bought this product also purchased
A814
A814
A2329
A2329
FGC7126
FGC7126
A1514
A1514
CTS10228
CTS10228
Y14605
Y14605
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies