Top » Catalog » SNPs » FGC31526

$18.00

FGC31526
[FGC31526]

FGC31526
HG19 Position: ChrY:15942956..15942956
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1a1 (not listed)
Comments: Downstream M222>S7072/S7073>S660
Forward Primer: FGC31526_F GACACCCTGAACCTTTGTGG
Reverse Primer: FGC31526_R CCCTAGCACGTTGTCACCTC
Reviews

Customers who bought this product also purchased
A223
A223
S588
S588
R1b-L21 Super-Clade Orientation Panel
R1b-L21 Super-Clade Orientation Panel
FGC52028
FGC52028
A16160
A16160
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies