Top » Catalog » SNPs » PH3893

$18.00

PH3893
[PH3893]

PH3893
hg38 Position: ChrY:16544158..16544158
Ancestral: G
Derived: A
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: E1b1b1b2a1a4d1a1a~
Comments: Downstream Y4970. Napoleonic branch
Forward Primer: PH3893_F TGTGGTGTCTGGTTTTTAATGC
Reverse Primer: PH3893_R GCCAACACTATTAAAACCAATTAAGC
Reviews

Customers who bought this product also purchased
V1169
V1169
Y38890
Y38890
FT109413
FT109413
Y341630
Y341630
BY36878
BY36878
Y16161
Y16161
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies