Top » Catalog » SNPs » U106

$18.00

U106
[U106]

U106
hg38 Position: ChrY:8928037..8928037
Ancestral: C
Derived: T
Reference: Sims et al. 2007
ISOGG Haplogroup: R1b1a1a2a1a1
Comments: aka M405 S21
Forward Primer: U106_F GCTCTGGTGCATAGGGATTC
Reverse Primer: U106_R AGTCTGAACTCTTGGGAGATGG
Reviews

Customers who bought this product also purchased
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
L943
L943
Z2106
Z2106
FGC14590
FGC14590
R1b-Z2103 Panel
R1b-Z2103 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies