Top » Catalog » SNPs » U106

$18.00

U106
[U106]

U106
hg38 Position: ChrY:8928037..8928037
Ancestral: C
Derived: T
Reference: Sims et al. 2007
ISOGG Haplogroup: R1b1a1b1a1a1
Comments: Aka M405 and S21. Below M269 > L151
Forward Primer: U106_F GCTCTGGTGCATAGGGATTC
Reverse Primer: U106_R AGTCTGAACTCTTGGGAGATGG
Reviews

Customers who bought this product also purchased
L11
L11
Y167401
Y167401
S1194
S1194
Z2109
Z2109
Y14514
Y14514
CTS7822
CTS7822
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies