Top » Catalog » SNPs » U106

$18.00

U106
[U106]

U106
hg38 Position: ChrY:8928037..8928037
Ancestral: C
Derived: T
Reference: Sims et al. 2007
ISOGG Haplogroup: R1b1a1a2a1a1
Comments: aka M405 S21
Forward Primer: U106_F GCTCTGGTGCATAGGGATTC
Reverse Primer: U106_R AGTCTGAACTCTTGGGAGATGG
Reviews

Customers who bought this product also purchased
FGC13333
FGC13333
FGC51008
FGC51008
S1911
S1911
S18823
S18823
FGC51006
FGC51006
Z4303
Z4303
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies