Top » Catalog » SNPs » U106

$18.00

U106
[U106]

U106
hg38 Position: ChrY:8928037..8928037
Ancestral: C
Derived: T
Reference: Sims et al. 2007
ISOGG Haplogroup: R1b1a1b1a1a1
Comments: Aka M405 and S21. Below M269 > L151
Forward Primer: U106_F GCTCTGGTGCATAGGGATTC
Reverse Primer: U106_R AGTCTGAACTCTTGGGAGATGG
Reviews

Customers who bought this product also purchased
CTS3104
CTS3104
Y83097
Y83097
Y18625
Y18625
BY18060
BY18060
S5918
S5918
S5940
S5940
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies