Top » Catalog » SNPs » L260

$18.00

L260
[L260]

L260
hg38 Position: ChrY:16136950..16136950
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1a1a1b1a1a
Comments: Found in a R-M458* WTY participant
Forward Primer: L260_F GGGAAGAGGGGAGAAGATTG
Reverse Primer: L260_R CCACGTGAGATGTGGAGTTC
Reviews

Customers who bought this product also purchased
Y74045
Y74045
Y128286
Y128286
Y128293
Y128293
Y51378
Y51378
FT186708
FT186708
Y184194
Y184194
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies