Top » Catalog » SNPs » L260

$18.00

L260
[L260]

L260
hg38 Position: ChrY:16136950..16136950
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1a1a1b1a1a
Comments: Found in a R-M458* WTY participant
Forward Primer: L260_F GGGAAGAGGGGAGAAGATTG
Reverse Primer: L260_R CCACGTGAGATGTGGAGTTC
Reviews

Customers who bought this product also purchased
Y14244
Y14244
YP870
YP870
YP5297
YP5297
BY56733
BY56733
BY35658
BY35658
A13144
A13144
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies