Top » Catalog » SNPs » L260

$18.00

L260
[L260]

L260
hg38 Position: ChrY:16136950..16136950
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1a1a1b1a1a
Comments: Found in a R-M458* WTY participant
Forward Primer: L260_F GGGAAGAGGGGAGAAGATTG
Reverse Primer: L260_R CCACGTGAGATGTGGAGTTC
Reviews

Customers who bought this product also purchased
BY179631
BY179631
BY30779
BY30779
DYS570
DYS570
Y37285
Y37285
DYS576
DYS576
Y166625
Y166625
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies