Top » Catalog » SNPs » L260

$18.00

L260
[L260]

L260
hg38 Position: ChrY:16136950..16136950
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1a1a1b1a1a
Comments: Found in a R-M458* WTY participant
Forward Primer: L260_F GGGAAGAGGGGAGAAGATTG
Reverse Primer: L260_R CCACGTGAGATGTGGAGTTC
Reviews

Customers who bought this product also purchased
Y17491
Y17491
L145
L145
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
BY82741
BY82741
Y70897
Y70897
BY30715
BY30715
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies