Top » Catalog » SNPs » L260

$18.00

L260
[L260]

L260
hg38 Position: ChrY:16136950..16136950
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1a1a1b1a1a
Comments: Found in a R-M458* WTY participant
Forward Primer: L260_F GGGAAGAGGGGAGAAGATTG
Reverse Primer: L260_R CCACGTGAGATGTGGAGTTC
Reviews

Customers who bought this product also purchased
BY82741
BY82741
Y70897
Y70897
FGC66342
FGC66342
BY164730
BY164730
Y129780
Y129780
Y128623
Y128623
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies