Top » Catalog » SNPs » YP254

$18.00

YP254
[YP254]

YP254
hg38 Position: ChrY:9554588..9554588
Ancestral: A
Derived: G
Reference: YFull (2014)
ISOGG Haplogroup: R1a1a1b1a1a1a
Comments: Downstream of YP258
Forward Primer: YP254_F ATCCTCCCACCTCAGCCTC
Reverse Primer: YP254_R TAAGTTATAAACATGTATCTTTTCATACGC
Reviews

Customers who bought this product also purchased
YP5297
YP5297
BY35658
BY35658
YP5952
YP5952
Y87380
Y87380
M198
M198
Y140901
Y140901
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies