Top » Catalog » SNPs » YP254

$18.00

YP254
[YP254]

YP254
hg38 Position: ChrY:9554588..9554588
Ancestral: A
Derived: G
Reference: YFull (2014)
ISOGG Haplogroup: R1a1a1b1a1a1a
Comments: Downstream of YP258
Forward Primer: YP254_F ATCCTCCCACCTCAGCCTC
Reverse Primer: YP254_R TAAGTTATAAACATGTATCTTTTCATACGC
Reviews

Customers who bought this product also purchased
PF6155
PF6155
Y17491
Y17491
L62
L62
FT186708
FT186708
L145
L145
Y184194
Y184194
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies