Top » Catalog » SNPs » YP254

$18.00

YP254
[YP254]

YP254
hg38 Position: ChrY:9554588..9554588
Ancestral: A
Derived: G
Reference: YFull (2014)
ISOGG Haplogroup: R1a1a1b1a1a1a
Comments: Downstream of YP258
Forward Primer: YP254_F ATCCTCCCACCTCAGCCTC
Reverse Primer: YP254_R TAAGTTATAAACATGTATCTTTTCATACGC
Reviews

Customers who bought this product also purchased
BY142582
BY142582
BY29798
BY29798
YP654
YP654
R1a-Z280 Panel
R1a-Z280 Panel
Z92
Z92
Y139304
Y139304
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies