Top » Catalog » SNPs » YP254

$18.00

YP254
[YP254]

YP254
hg38 Position: ChrY:9554588..9554588
Ancestral: A
Derived: G
Reference: YFull (2014)
ISOGG Haplogroup: R1a1a1b1a1a1a
Comments: Downstream of YP258
Forward Primer: YP254_F ATCCTCCCACCTCAGCCTC
Reverse Primer: YP254_R TAAGTTATAAACATGTATCTTTTCATACGC
Reviews

Customers who bought this product also purchased
YP619
YP619
BY179631
BY179631
BY30779
BY30779
FGC39940
FGC39940
Y166625
Y166625
DYS518
DYS518
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies